test_geo
Testing Bio.Geo on GSE16.txt


GEO Type: SAMPLE
GEO Id: GSM804
Sample_author: Antoine,M,Snijders

Sample_author: Norma,,Nowak

Sample_author: Richard,,Segraves

Sample_author: Stephanie,,Blackwood

Sample_author: Nils,,Brown

Sample_author: Jeffery,,Conroy

Sample_author: Greg,,Hamilton

Sample_author: Anna,K,Hindle

Sample_author: Bing,,Huey

Sample_author: Karen,,Kimura

Sample_author: Sindy,,Law

Sample_author: Ken,,Myambo

Sample_author: Joel,,Palmer

Sample_author: Bauke,,Ylstra

Sample_author: Jingzhu,P,Yue

Sample_author: Joe,W,Gray

Sample_author: Ajay,N,Jain

Sample_author: Daniel,,Pinkel

Sample_author: Donna,G,Albertson

Sample_description: Coriell Cell Repositories cell line <a h
ref="http://locus.umdnj.edu/nigms/nigms_cgi/display.cgi?GM05296">GM05296</a>.

Sample_description: Fibroblast cell line derived from a 1 mo
nth old female with multiple congenital malformations, dysmorphic features, intr
auterine growth retardation, heart murmur, cleft palate, equinovarus deformity, 
microcephaly, coloboma of right iris, clinodactyly, reduced RBC catalase activit
y, and 1 copy of catalase gene.

Sample_description: Chromosome abnormalities are present.

Sample_description: Karyotype is 46,XX,-11,+der(11)inv ins(1
1;10)(11pter> 11p13::10q21>10q24::11p13>11qter)mat

Sample_organism: Homo sapiens

Sample_platform_id: GPL28

Sample_pubmed_id: 11687795

Sample_series_id: GSE16

Sample_status: Public on Feb 12 2002

Sample_submission_date: Jan 17 2002

Sample_submitter_city: San Francisco,CA,94143,USA

Sample_submitter_department: Comprehensive Cancer Center

Sample_submitter_email: albertson@cc.ucsf.edu

Sample_submitter_institute: University of California San Francisco

Sample_submitter_name: Donna,G,Albertson

Sample_submitter_phone: 415 502-8463

Sample_target_source1: Cell line GM05296

Sample_target_source2: normal male reference genomic DNA

Sample_title: CGH_Albertson_GM05296-001218

Sample_type: dual channel genomic

Column Header Definitions
    ID_REF: Unique row identifier, genome position o
    rder

    LINEAR_RATIO: Mean of replicate Cy3/Cy5 ratios

    LOG2STDDEV: Standard deviation of VALUE

    NO_REPLICATES: Number of replicate spot measurements

    VALUE: aka LOG2RATIO, mean of log base 2 of LIN
    EAR_RATIO

0: ID_REF	VALUE	LINEAR_RATIO	LOG2STDDEV	NO_REPLICATES	
1: 1		1.047765	0.011853	3	
2: 2				0	
3: 3	0.008824	1.006135	0.00143	3	
4: 4	-0.000894	0.99938	0.001454	3	
5: 5	0.075875	1.054	0.003077	3	
6: 6	0.017303	1.012066	0.005876	2	
7: 7	-0.006766	0.995321	0.013881	3	
8: 8	0.020755	1.014491	0.005506	3	
9: 9	-0.094938	0.936313	0.012662	3	
10: 10	-0.054527	0.96291	0.01073	3	
11: 11	-0.025057	0.982782	0.003855	3	
12: 12				0	
13: 13	0.108454	1.078072	0.005196	3	
14: 14	0.078633	1.056017	0.009165	3	
15: 15	0.098571	1.070712	0.007834	3	
16: 16	0.044048	1.031003	0.013651	3	
17: 17	0.018039	1.012582	0.005471	3	
18: 18	-0.088807	0.9403	0.010571	3	
19: 19	0.016349	1.011397	0.007113	3	
20: 20	0.030977	1.021704	0.016798	3	



Testing Bio.Geo on GSM645.txt


GEO Type: SAMPLE
GEO Id: GSM645
Sample_author: Reinhard,,Hoffmann

Sample_author: Thomas,,Seidl

Sample_author: Ton,,Rolink

Sample_author: Fritz,,Melchers

Sample_description: B220+CD25+sIg- Large Pre BII cells sorte
d out of mouse bone marrow, sort no. 8

Sample_organism: Mus musculus

Sample_platform_id: GPL22

Sample_series_id: GSE13

Sample_status: Public on Dec 17 2001

Sample_submission_date: Nov 27 2001

Sample_submitter_address: Pettenkoferstr. 9a

Sample_submitter_city: Munich,80336,Germany

Sample_submitter_department: Bacteriology

Sample_submitter_email: r_hoffmann@m3401.mpk.med.uni-muenchen.de

Sample_submitter_institute: Max von Pettenkofer Institut

Sample_submitter_name: Reinhard,,Hoffmann

Sample_submitter_phone: +49-89-5160-5424

Sample_target_source: Large Pre-BII cells

Sample_title: Large Pre-BII cells 8b

Sample_type: single channel

Column Header Definitions
    ABS_CALL: Whether a probe set is present, marginal
    , or absent; see Affymetrix Literature

    Experiment Name: Experiment Name

    ID_REF: Affymetrix Probe Set Identifier

    Log Avg: 

    MM Excess: Number of probe peirs where MM/PM exceed
    s 1/ratio limit (10 by default)

    NEGATIVE: number of negative probe pairs

    PAIRS: number of probe set specific probe pairs
     on the array

    PAIRS_IN_AVG: Trimmed probe pair set

    PAIRS_USED: 

    PM Excess: number of probe pairs  where PM/MM excee
    ds the ratio limit (10 by default)

    POS/NEG: Positive/Negative

    POSITIVE: number of poisitive probe pairs

    POS_FRACTION: Positive/Pairs Used

    VALUE: Average Difference Intensity

0: ID_REF	Experiment Name	POSITIVE	NEGATIVE	PAIRS	PAIRS_USED	PAIRS_IN_AVG	POS_FRACTION	Log Avg	PM Excess	MM Excess	POS/NEG	VALUE	ABS_CALL	
1: IL2_at	RHMu8LarB	4	4	19	19	19	0.21	-0.58	0	0	1.0	-78	A	
2: IL10_at	RHMu8LarB	7	4	20	20	18	0.35	1.87	1	0	1.8	161	A	
3: GMCSF_at	RHMu8LarB	4	4	20	20	19	0.20	0.39	0	0	1.0	-11	A	
4: TNFRII_at	RHMu8LarB	2	2	20	20	18	0.10	0.48	0	0	1.0	52	A	
5: MIP1-B_at	RHMu8LarB	6	4	20	20	19	0.30	0.43	0	0	1.5	373	A	
6: IL4_at	RHMu8LarB	3	3	20	20	19	0.15	0.29	0	0	1.0	27	A	
7: IL12_P40_at	RHMu8LarB	3	5	20	20	19	0.15	-0.22	0	0	0.6	-163	A	
8: TNFa_at	RHMu8LarB	3	4	20	20	20	0.15	-0.57	1	0	0.8	-95	A	
9: TCRa_at	RHMu8LarB	1	4	20	20	19	0.05	-0.50	0	0	0.3	-186	A	
10: AFFX-BioB-5_at	RHMu8LarB	0	1	20	20	19	0.00	0.35	0	0	0.0	120	A	
11: AFFX-BioB-M_at	RHMu8LarB	0	1	20	20	19	0.00	0.02	0	0	0.0	-13	A	
12: AFFX-BioB-3_at	RHMu8LarB	2	0	20	20	19	0.10	0.38	0	0	Undef	136	A	
13: AFFX-BioC-5_at	RHMu8LarB	9	0	20	20	20	0.45	1.33	0	0	Undef	606	P	
14: AFFX-BioC-3_at	RHMu8LarB	2	0	20	20	19	0.10	0.64	0	0	Undef	257	A	
15: AFFX-BioDn-5_at	RHMu8LarB	8	0	20	20	20	0.40	1.23	0	0	Undef	380	P	
16: AFFX-BioDn-3_at	RHMu8LarB	16	0	20	20	19	0.80	2.79	0	0	Undef	2764	P	
17: AFFX-CreX-5_at	RHMu8LarB	19	0	20	20	19	0.95	5.65	0	0	Undef	4391	P	
18: AFFX-CreX-3_at	RHMu8LarB	19	0	20	20	20	0.95	6.42	2	0	Undef	10787	P	
19: AFFX-BioB-5_st	RHMu8LarB	5	3	20	20	19	0.25	0.48	0	0	1.7	80	A	
20: AFFX-BioB-M_st	RHMu8LarB	2	3	20	20	17	0.10	0.16	0	0	0.7	24	A	



Testing Bio.Geo on GSM691.txt


GEO Type: SAMPLE
GEO Id: GSM691
Sample_anchor: NlaIII

Sample_author: Jeffrey,,Marks

Sample_author: Gregory,J,Riggins

Sample_author: Robert,L,Strausberg

Sample_description: This library represents a Cancer Genome 
Anatomy Project library, which was either produced through CGAP funding, or dona
ted to CGAP.

Sample_description: The Cancer Genome Anatomy Project (CGAP:
 http://cgap.nci.nih.gov) is an interdisciplinary program established and admini
stered by the National Cancer Institute (NCI: http://www.nci.nih.gov) to generat
e the information and technological tools needed to decipher the molecular anato
my of the cancer cell.

Sample_description: Library constructed by Riggins laborator
y Tissue supplied by Jeffrey Marks, Ph.D.

Sample_description: Organ: Breast

Sample_description: Tissue_type: normal epithelial organoids

Sample_description: Library treatment: non-normalized

Sample_description: Tissue description: Breast, Isolated nor
mal epithelial organoids. Derived from a reduction mammoplasty.

Sample_description: Tissue supplier: Jeffrey Marks, Ph.D.

Sample_description: Sample type: Bulk

Sample_description: Producer: Riggins Laboratory

Sample_description: Clones generated to date: 768

Sample_description: Sequences generated to date: 572

Sample_organism: Homo sapiens

Sample_platform_id: GPL4

Sample_series_id: GSE14

Sample_status: Public on Nov 28 2001

Sample_submission_date: Nov 28 2001

Sample_submitter_city: Bethesda,MD,20892,USA

Sample_submitter_department: Cancer Genome Anatomy Project

Sample_submitter_email: cgapbs-r@mail.nih.gov

Sample_submitter_institute: National Cancer Institute

Sample_submitter_name: Robert,L,Strausberg

Sample_submitter_phone: 301-496-1550

Sample_submitter_web_link: http://cgap.nci.nih.gov/

Sample_tag_count: 7165

Sample_target_source: Breast, isolated normal epithelial organ
oids

Sample_title: SAGE_Duke_40N

Sample_type: sage

Sample_web_link: http://cgap.nci.nih.gov

Column Header Definitions
    COUNT: Absolute tag count

    TAG: Ten base SAGE tag, LINK_PRE:"http://www.
    ncbi.nlm.nih.gov/SAGE/SAGEtag.cgi?tag

    TPM: Tags per million, or (1000000*COUNT)/(To
    tal tags)

0: TAG	COUNT	TPM	
1: TTGGGGTTTC	202	28192.6	
2: TAGGTTGTCT	129	18004.2	
3: GAGGGAGTTT	109	15212.8	
4: TGCACGTTTT	92	12840.2	
5: CTGGGTTAAT	83	11584.1	
6: GTTGTGGTTA	82	11444.5	
7: GATCCCAACT	63	8792.74	
8: TGCAGTCACT	59	8234.47	
9: GGATTTGGCC	58	8094.91	
10: GGGCTGGGGT	56	7815.77	
11: ATAATTCTTT	44	6140.96	
12: CTTCCTTGCC	42	5861.83	
13: TTGGTCCTCT	40	5582.69	
14: GGCAAGCCCC	36	5024.42	
15: AACTAAAAAA	34	4745.29	
16: AGGGCTTCCA	34	4745.29	
17: AGGCTACGGA	33	4605.72	
18: GTGAAACCCC	32	4466.15	
19: AACTAACAAA	31	4326.59	
20: GAAAAATGGT	30	4187.02	



Testing Bio.Geo on GSM700.txt


GEO Type: SAMPLE
GEO Id: GSM700
Sample_anchor: NlaIII

Sample_author: Gregory,J,Riggins

Sample_author: Robert,L,Strausberg

Sample_description: This library represents a Cancer Genome 
Anatomy Project library, which was either produced through CGAP funding, or dona
ted to CGAP.

Sample_description: The Cancer Genome Anatomy Project (CGAP:
 http://cgap.nci.nih.gov) is an interdisciplinary program established and admini
stered by the National Cancer Institute (NCI: http://www.nci.nih.gov) to generat
e the information and technological tools needed to decipher the molecular anato
my of the cancer cell.

Sample_description: Cell line grown under 1.5% oxygen condit
ions for 24 hours prior to harvesting in zinc option media with 10% RBS and harv
ested at passage 102. Library constructed in the laboratory of G. Riggins, M.D.,
 Ph.D. (Duke University).

Sample_description: Organ: brain

Sample_description: Tissue_type: glioblastoma multiforme

Sample_description: Cell_line: H247

Sample_description: Lab host: DH10B

Sample_description: Vector: pZErO-1

Sample_description: Vector type: plasmid

Sample_description: R. Site 1: Sph1

Sample_description: R. Site 2: Sph1

Sample_description: Library treatment: non-normalized

Sample_description: Tissue description: Brain, Duke glioblas
toma multiforme cell line, H247, grown under 1.5% oxygen conditions  for 24 hour
s prior to harvesting.

Sample_description: Tissue

Sample_organism: Homo sapiens

Sample_platform_id: GPL4

Sample_series_id: GSE14

Sample_status: Public on Nov 28 2001

Sample_submission_date: Nov 28 2001

Sample_submitter_city: Bethesda,MD,20892,USA

Sample_submitter_department: Cancer Genome Anatomy Project

Sample_submitter_email: cgapbs-r@mail.nih.gov

Sample_submitter_institute: National Cancer Institute

Sample_submitter_name: Robert,L,Strausberg

Sample_submitter_phone: 301-496-1550

Sample_submitter_web_link: http://cgap.nci.nih.gov/

Sample_tag_count: 72031

Sample_target_source: Brain, glioblastoma multiforme, cell-lin
e H247

Sample_title: SAGE_Duke_H247_Hypoxia

Sample_type: sage

Sample_web_link: http://cgap.nci.nih.gov

Column Header Definitions
    COUNT: Absolute tag count

    TAG: Ten base SAGE tag, LINK_PRE:"http://www.
    ncbi.nlm.nih.gov/SAGE/SAGEtag.cgi?tag

    TPM: Tags per million, or (1000000*COUNT)/(To
    tal tags)

0: TAG	COUNT	TPM	
1: TCCAAATCGA	520	7219.11	
2: TACCATCAAT	434	6025.18	
3: TTGGGGTTTC	389	5400.45	
4: CCCATCGTCC	367	5095.03	
5: GTGAAACCCC	365	5067.26	
6: GGGGAAATCG	357	4956.2	
7: CCTGTAATCC	346	4803.49	
8: TGATTTCACT	334	4636.89	
9: TGTGTTGAGA	315	4373.12	
10: GCCCCCAATA	303	4206.52	
11: CTAAGACTTC	279	3873.33	
12: GCGACCGTCA	276	3831.68	
13: TTGGTCCTCT	276	3831.68	
14: CCTAGCTGGA	268	3720.62	
15: GATGAGGAGA	251	3484.61	
16: ACTTTTTCAA	244	3387.43	
17: CCACTGCACT	223	3095.89	
18: GTGTGTTTGT	223	3095.89	
19: GAAATACAGT	218	3026.47	
20: GCTTTATTTG	218	3026.47	



Testing Bio.Geo on GSM804.txt


GEO Type: SAMPLE
GEO Id: GSM804
Sample_author: Antoine,M,Snijders

Sample_author: Norma,,Nowak

Sample_author: Richard,,Segraves

Sample_author: Stephanie,,Blackwood

Sample_author: Nils,,Brown

Sample_author: Jeffery,,Conroy

Sample_author: Greg,,Hamilton

Sample_author: Anna,K,Hindle

Sample_author: Bing,,Huey

Sample_author: Karen,,Kimura

Sample_author: Sindy,,Law

Sample_author: Ken,,Myambo

Sample_author: Joel,,Palmer

Sample_author: Bauke,,Ylstra

Sample_author: Jingzhu,P,Yue

Sample_author: Joe,W,Gray

Sample_author: Ajay,N,Jain

Sample_author: Daniel,,Pinkel

Sample_author: Donna,G,Albertson

Sample_description: Coriell Cell Repositories cell line <a h
ref="http://locus.umdnj.edu/nigms/nigms_cgi/display.cgi?GM05296">GM05296</a>.

Sample_description: Fibroblast cell line derived from a 1 mo
nth old female with multiple congenital malformations, dysmorphic features, intr
auterine growth retardation, heart murmur, cleft palate, equinovarus deformity, 
microcephaly, coloboma of right iris, clinodactyly, reduced RBC catalase activit
y, and 1 copy of catalase gene.

Sample_description: Chromosome abnormalities are present.

Sample_description: Karyotype is 46,XX,-11,+der(11)inv ins(1
1;10)(11pter> 11p13::10q21>10q24::11p13>11qter)mat

Sample_organism: Homo sapiens

Sample_platform_id: GPL28

Sample_pubmed_id: 11687795

Sample_series_id: GSE16

Sample_status: Public on Feb 12 2002

Sample_submission_date: Jan 17 2002

Sample_submitter_city: San Francisco,CA,94143,USA

Sample_submitter_department: Comprehensive Cancer Center

Sample_submitter_email: albertson@cc.ucsf.edu

Sample_submitter_institute: University of California San Francisco

Sample_submitter_name: Donna,G,Albertson

Sample_submitter_phone: 415 502-8463

Sample_target_source1: Cell line GM05296

Sample_target_source2: normal male reference genomic DNA

Sample_title: CGH_Albertson_GM05296-001218

Sample_type: dual channel genomic

Column Header Definitions
    ID_REF: Unique row identifier, genome position o
    rder

    LINEAR_RATIO: Mean of replicate Cy3/Cy5 ratios

    LOG2STDDEV: Standard deviation of VALUE

    NO_REPLICATES: Number of replicate spot measurements

    VALUE: aka LOG2RATIO, mean of log base 2 of LIN
    EAR_RATIO

0: ID_REF	VALUE	LINEAR_RATIO	LOG2STDDEV	NO_REPLICATES	
1: 1		1.047765	0.011853	3	
2: 2				0	
3: 3	0.008824	1.006135	0.00143	3	
4: 4	-0.000894	0.99938	0.001454	3	
5: 5	0.075875	1.054	0.003077	3	
6: 6	0.017303	1.012066	0.005876	2	
7: 7	-0.006766	0.995321	0.013881	3	
8: 8	0.020755	1.014491	0.005506	3	
9: 9	-0.094938	0.936313	0.012662	3	
10: 10	-0.054527	0.96291	0.01073	3	
11: 11	-0.025057	0.982782	0.003855	3	
12: 12				0	
13: 13	0.108454	1.078072	0.005196	3	
14: 14	0.078633	1.056017	0.009165	3	
15: 15	0.098571	1.070712	0.007834	3	
16: 16	0.044048	1.031003	0.013651	3	
17: 17	0.018039	1.012582	0.005471	3	
18: 18	-0.088807	0.9403	0.010571	3	
19: 19	0.016349	1.011397	0.007113	3	
20: 20	0.030977	1.021704	0.016798	3	



Testing Bio.Geo on soft_ex_affy.txt


GEO Type: SAMPLE
GEO Id: body wall rep1
Sample_characteristics: Wild type, third instar larvae, body wal
l

Sample_data_processing: Affymetrix Microarray Suite version 5.0

Sample_description: Wild type third instar larvae imaginal w
ing discs

Sample_extract_protocol: Approximately 200 wild-type (Berlin stra
in) wandering third-instar larvae were dissected and the wing discs were collect
ed in a drop of PBS on Sylgard (Dow Corning). Discs were cut between the presump
tive hinge and the body wall regions using a 30-gauge syringe needle, and fragme
nts were lysed in separate groups in RLT buffer (Qiagen).Total RNA was extracted
 from the tissue lysate using an RNeasy kit (Qiagen).

Sample_hyb_protocol: standard Affymetrix procedures

Sample_label: biotin

Sample_label_protocol: Approximately 8 g of total RNA was proc
essed to produce biotinylated cRNA targets.

Sample_molecule: total RNA

Sample_organism: Drosophila melanogaster

Sample_platform_id: GPL72

Sample_scan_protocol: standard Affymetrix procedures

Sample_source_name: body wall

Sample_title: body wall replicate 1

Column Header Definitions
    ABS_CALL: the call in an absolute analysis that in
    dicates if the transcript was present (P), absent (A), marginal (M), or no call 
    (NC)

    DETECTION P-VALUE: 'detection p-value', p-value that indica
    tes the significance level of the detection call

    ID_REF: 

    VALUE: MAS5-calculated Signal intensity

0: ID_REF	VALUE	ABS_CALL	DETECTION P-VALUE	
1: 141200_at	36.6	A	0.818657	
2: 141201_at	41.5	A	0.703191	
3: 141202_at	607.3	P	0.000944	
4: 141203_at	1509.1	P	0.000762	
5: 141204_at	837.3	P	0.000613	
6: 141205_at	363.2	P	0.003815	
7: 141206_at	1193.6	P	0.000491	
8: 141207_at	346.6	P	0.001165	
9: 141208_at	257.8	P	0.006575	
10: 141209_at	337.1	P	0.002607	
11: 141210_at	48	A	0.150145	
12: 141211_at	130.7	P	0.005504	
13: 141212_at	1454.3	P	0.000491	
14: 141213_at	21.2	A	0.635055	
15: 141214_at	2372.6	P	0.000491	
16: 141215_at	452.9	P	0.017732	
17: 141216_at	504.1	P	0.006575	
18: 141217_at	716.9	P	0.004591	
19: 141218_at	3248.8	P	0.000491	
20: 141219_at	223.5	P	0.007827	

GEO Type: SAMPLE
GEO Id: body wall rep2
Sample_characteristics: Wild type, third instar larvae, body wal
l

Sample_data_processing: Affymetrix Microarray Suite version 5.0

Sample_description: Wild type third instar larvae imaginal w
ing discs

Sample_extract_protocol: Approximately 200 wild-type (Berlin stra
in) wandering third-instar larvae were dissected and the wing discs were collect
ed in a drop of PBS on Sylgard (Dow Corning). Discs were cut between the presump
tive hinge and the body wall regions using a 30-gauge syringe needle, and fragme
nts were lysed in separate groups in RLT buffer (Qiagen).Total RNA was extracted
 from the tissue lysate using an RNeasy kit (Qiagen).

Sample_hyb_protocol: standard Affymetrix procedures

Sample_label: biotin

Sample_label_protocol: Approximately 8 g of total RNA was proc
essed to produce biotinylated cRNA targets.

Sample_molecule: total RNA

Sample_organism: Drosophila melanogaster

Sample_platform_id: GPL72

Sample_scan_protocol: standard Affymetrix procedures

Sample_source_name: body wall

Sample_title: body wall replicate 2

Column Header Definitions
    ABS_CALL: the call in an absolute analysis that in
    dicates if the transcript was present (P), absent (A), marginal (M), or no call 
    (NC)

    DETECTION P-VALUE: 'detection p-value', p-value that indica
    tes the significance level of the detection call

    ID_REF: 

    VALUE: MAS5-calculated Signal intensity

0: ID_REF	VALUE	ABS_CALL	DETECTION P-VALUE	
1: 141200_at	70.3	A	0.216313	
2: 141201_at	38	A	0.635055	
3: 141202_at	831.8	P	0.000613	
4: 141203_at	2215.5	P	0.000944	
5: 141204_at	965.6	P	0.000491	
6: 141205_at	383.2	P	0.001432	
7: 141206_at	1195	P	0.000491	
8: 141207_at	413.7	P	0.000613	
9: 141208_at	447.3	P	0.000762	
10: 141209_at	294.4	P	0.004591	
11: 141210_at	81.7	M	0.054711	
12: 141211_at	84.9	P	0.005504	
13: 141212_at	1456.4	P	0.000491	
14: 141213_at	37	A	0.122747	
15: 141214_at	2022	P	0.000491	
16: 141215_at	690.9	P	0.004591	
17: 141216_at	525.1	P	0.000762	
18: 141217_at	643.5	P	0.000613	
19: 141218_at	2570.5	P	0.000491	
20: 141219_at	265.9	P	0.005504	

GEO Type: SAMPLE
GEO Id: wing/hinge rep1
Sample_characteristics: Wild type, third instar larvae, wing/hin
ge

Sample_data_processing: Affymetrix Microarray Suite version 5.0

Sample_description: Wild type third instar larvae imaginal w
ing discs

Sample_extract_protocol: Approximately 200 wild-type (Berlin stra
in) wandering third-instar larvae were dissected and the wing discs were collect
ed in a drop of PBS on Sylgard (Dow Corning). Discs were cut between the presump
tive hinge and the body wall regions using a 30-gauge syringe needle, and fragme
nts were lysed in separate groups in RLT buffer (Qiagen).Total RNA was extracted
 from the tissue lysate using an RNeasy kit (Qiagen).

Sample_hyb_protocol: standard Affymetrix procedures

Sample_label: biotin

Sample_label_protocol: Approximately 8 g of total RNA was proc
essed to produce biotinylated cRNA targets.

Sample_molecule: total RNA

Sample_organism: Drosophila melanogaster

Sample_platform_id: GPL72

Sample_scan_protocol: standard Affymetrix procedures

Sample_source_name: wing/hinge

Sample_title: wing/hinge replicate 1

Column Header Definitions
    ABS_CALL: the call in an absolute analysis that in
    dicates if the transcript was present (P), absent (A), marginal (M), or no call 
    (NC)

    DETECTION P-VALUE: 'detection p-value', p-value that indica
    tes the significance level of the detection call

    ID_REF: 

    VALUE: MAS5-calculated Signal intensity

0: ID_REF	VALUE	ABS_CALL	DETECTION P-VALUE	
1: 141200_at	20.8	A	0.801637	
2: 141201_at	85.8	A	0.48748	
3: 141202_at	704.8	P	0.000613	
4: 141203_at	1036.6	P	0.000944	
5: 141204_at	700.3	P	0.000491	
6: 141205_at	462.4	P	0.003159	
7: 141206_at	1301.9	P	0.000491	
8: 141207_at	454.8	P	0.000944	
9: 141208_at	438.6	P	0.000944	
10: 141209_at	264.4	P	0.004591	
11: 141210_at	65.6	A	0.150145	
12: 141211_at	72.2	A	0.070073	
13: 141212_at	1200	P	0.000491	
14: 141213_at	13.7	A	0.635055	
15: 141214_at	1944	P	0.000491	
16: 141215_at	465.5	P	0.005504	
17: 141216_at	538.9	P	0.002607	
18: 141217_at	753.9	P	0.003159	
19: 141218_at	2942.6	P	0.000491	
20: 141219_at	283.9	P	0.010972	



Testing Bio.Geo on soft_ex_dual.txt


GEO Type: SAMPLE
GEO Id: HS-5 cells rep 1
Sample_characteristics_ch1: Human bone marrow stromal cells, HS-5

Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S
tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap
proximating the expression profile of the majority of human genes was used.

Sample_data_processing: After background correction and removal 
of flagged values, log base 2 expression ratios were mean centered and linear tr
ansformed to obtain the log and linear values given in the data table.

Sample_description: Human bone marrow stromal cells, HS-5 ce
lls

Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag
en RNeasy Mini Kit reagents. The RNA (30 g) was annealed with 5 g oligo dT12-1
8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f
or 2h at 42C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d
TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re
moved from the reaction with a Microcon-30 concentrator.

Sample_extract_protocol_ch2: The RNA (30 g) was annealed with 5 g o
ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran
scriptase for 2h at 42C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT
P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, 
Tris was removed from the reaction with a Microcon-30 concentrator.

Sample_growth_protocol_ch1: HS-5 cells cultured in RPMI medium 1640 
containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 ce
lls/flask. They were cultured for 3 days and harvested by trypsinization followe
d by pelleting of the cells.

Sample_label_ch1: Cy5

Sample_label_ch2: Cy3

Sample_label_protocol_ch1: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
 a QIAquick PCR purification kit and suspended in 36 l of 3X SSC and 0.8 mg/ml 
of poly-A for hybridization to the microarray.

Sample_label_protocol_ch2: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
 a QIAquick PCR purification kit and suspended in 36 l of 3X SSC and 0.8 mg/ml 
of poly-A for hybridization to the microarray.

Sample_molecule_ch1: total RNA

Sample_molecule_ch2: total RNA

Sample_organism_ch1: Homo sapiens

Sample_organism_ch2: Homo sapiens

Sample_platform_id: GPL1001

Sample_scan_protocol: Fluorescent array images were collected 
for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit
y data were extracted and analyzed with GenePix Pro 3.0 analysis software.

Sample_source_name_ch1: Human bone marrow stromal cells, HS-5 ce
lls

Sample_source_name_ch2: Universal human reference RNA

Sample_title: Human bone marrow stromal cells, HS-5 ce
lls, replicate 1

Column Header Definitions
    % > CH1_BKD_+2SD: Percent of feature pixels that were grea
    ter than two standard deviations of

    % > CH2_BKD_+2SD: Percent of feature pixels that were grea
    ter than two standard deviations of the background over the background signal

    AREA: Number of pixels used to calculate a fea
    ture's intensity

    BKD_AREA: Number of pixles used to calculate a fea
    ture's background

    CH1_BKD_ Mean: Channel 1 mean background intensity

    CH1_BKD_ Median: Channel 1 median background intensity

    CH1_BKD_ SD: Channel 1 background standard deviation

    CH1_Mean: Channel 1 mean intensity

    CH1_Mean - CH1_BKD_: Channel 1 mean signal

    CH1_Median: Channel 1 median intensity

    CH1_Median - CH1_BKD_: Channel 1 median signal

    CH1_SD: Channel 1 mean standard deviation

    CH2_BKD_ Mean: Channel 2 mean background intensity

    CH2_BKD_ Median: Channel 2 median background intensity

    CH2_BKD_ SD: Channel 2 background standard deviation

    CH2_Mean: Channel 2 mean intensity

    CH2_Mean - CH2_BKD_: Channel 2 mean signal

    CH2_Median: Channel 2 median intensity

    CH2_Median - CH2_BKD_: Channel 2 median signal

    CH2_SD: Channel 2 mean standard deviation

    Flags: 0 denotes satisfactory features, while <
    0 denotes features that did not meet

    ID_REF: 

    Ratio of Means: Unnormalized, untransformed ratio of mea
    ns

    VALUE: Normalized log2 ratio of means defined a
    s CH1 divided by CH2

0: ID_REF	VALUE	CH1_Median	CH1_Mean	CH1_SD	CH1_BKD_ Median	CH1_BKD_ Mean	CH1_BKD_ SD	% > CH1_BKD_+2SD	CH2_Median	CH2_Mean	CH2_SD	CH2_BKD_ Median	CH2_BKD_ Mean	CH2_BKD_ SD	% > CH2_BKD_+2SD	Ratio of Means	AREA	BKD_AREA	CH1_Median - CH1_BKD_	CH2_Median - CH2_BKD_	CH1_Mean - CH1_BKD_	CH2_Mean - CH2_BKD_	Flags	
1: 1	17.51	36	38	9	37	38	8	5	45	46	9	46	47	10	0	100000	80	500	-1	-1	1	0	-50	
2: 2	-0.10	42	47	19	37	39	11	12	64	65	15	45	47	10	43	0.5	32	176	5	19	10	20	-50	
3: 3	-0.42	44	48	18	36	38	8	37	75	75	17	45	46	10	71	0.4	32	176	8	30	12	30	-50	
4: 4	17.51	37	40	11	37	39	10	11	42	43	8	43	43	8	2	100000	80	498	0	-1	3	0	-50	
5: 5	0.95	147	193	125	37	39	8	98	157	194	109	43	44	9	98	1.033	52	398	110	114	156	151	0	
6: 6	0.79	57	62	21	37	39	9	55	69	71	14	44	45	8	76	0.926	52	329	20	25	25	27	-50	
7: 7	0.12	45	48	16	37	40	10	28	64	64	14	45	46	9	50	0.579	32	224	8	19	11	19	-50	
8: 8	0.68	54	54	17	36	38	9	48	63	64	13	43	44	8	57	0.857	80	510	18	20	18	21	-50	
9: 9	-0.10	51	53	16	36	38	9	44	73	77	19	43	44	9	84	0.5	52	406	15	30	17	34	-50	
10: 10	0.15	47	50	15	37	39	8	38	65	65	14	43	44	9	63	0.591	52	332	10	22	13	22	-50	
11: 11	-1.42	38	40	12	37	39	10	9	58	60	13	45	47	10	31	0.2	32	148	1	13	3	15	-50	
12: 12	-0.58	44	47	15	37	39	9	22	70	71	16	43	44	9	70	0.357	80	506	7	27	10	28	-50	
13: 13	0.08	63	63	24	36	38	9	63	85	91	21	43	44	9	94	0.563	52	382	27	42	27	48	0	
14: 14	-1.05	63	69	23	37	38	9	69	168	167	32	43	45	8	100	0.258	52	382	26	125	32	124	0	
15: 15	1.02	439	452	225	37	39	9	98	428	425	198	43	44	8	93	1.086	80	546	402	385	415	382	0	
16: 16	2.07	86	91	30	37	39	9	88	66	67	15	43	44	8	70	2.25	80	540	49	23	54	24	0	
17: 17	-0.79	40	44	14	36	39	10	11	67	69	15	43	44	9	73	0.308	52	384	4	24	8	26	-50	
18: 18	-0.57	50	51	16	37	39	10	37	79	82	22	43	44	9	83	0.359	80	570	13	36	14	39	-50	
19: 19	1.90	37	39	10	37	39	10	5	44	44	8	43	44	9	1	2	80	475	0	1	2	1	-50	
20: 20	-0.99	42	44	11	37	39	9	9	65	69	16	43	45	9	61	0.269	52	388	5	22	7	26	-50	

GEO Type: SAMPLE
GEO Id: HS-27a cells
Sample_characteristics_ch1: Human bone marrow stromal cells, HS-27a

Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S
tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap
proximating the expression profile of the majority of human genes was used.

Sample_data_processing: After background correction and removal 
of flagged values, log base 2 expression ratios were mean centered and linear tr
ansformed to obtain the log and linear values given in the data table.

Sample_description: Human bone marrow stromal cells, HS-27a 
cells

Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag
en RNeasy Mini Kit reagents. The RNA (30 g) was annealed with 5 g oligo dT12-1
8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f
or 2h at 42C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d
TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re
moved from the reaction with a Microcon-30 concentrator.

Sample_extract_protocol_ch2: The RNA (30 g) was annealed with 5 g o
ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran
scriptase for 2h at 42C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT
P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, 
Tris was removed from the reaction with a Microcon-30 concentrator.

Sample_growth_protocol_ch1: HS-27a cells cultured in RPMI medium 164
0 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 
cells/flask. They were cultured for 3 days and harvested by trypsinization follo
wed by pelleting of the cells.

Sample_label_ch1: Cy5

Sample_label_ch2: Cy3

Sample_label_protocol_ch1: The cDNA from HS-27a RNA and Human Unive
rsal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors,
 respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2
.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified wi
th a QIAquick PCR purification kit and suspended in 36 l of 3X SSC and 0.8 mg/m
l of poly-A for hybridization to the microarray.

Sample_label_protocol_ch2: The cDNA from HS-27a RNA and Human Unive
rsal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors,
 respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2
.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified wi
th a QIAquick PCR purification kit and suspended in 36 l of 3X SSC and 0.8 mg/m
l of poly-A for hybridization to the microarray.

Sample_molecule_ch1: total RNA

Sample_molecule_ch2: total RNA

Sample_organism_ch1: Homo sapiens

Sample_organism_ch2: Homo sapiens

Sample_platform_id: GPL1001

Sample_scan_protocol: Fluorescent array images were collected 
for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit
y data were extracted and analyzed with GenePix Pro 3.0 analysis software.

Sample_source_name_ch1: Human bone marrow stromal cells, HS-27a

Sample_source_name_ch2: Universal human reference RNA

Sample_title: HS-27a cells.

Column Header Definitions
    % > CH1_BKD_+2SD: Percent of feature pixels that were grea
    ter than two standard deviations of

    % > CH2_BKD_+2SD: Percent of feature pixels that were grea
    ter than two standard deviations of the background over the background signal

    AREA: Number of pixels used to calculate a fea
    ture's intensity

    BKD_AREA: Number of pixles used to calculate a fea
    ture's background

    CH1_BKD_ Mean: Channel 1 mean background intensity

    CH1_BKD_ Median: Channel 1 median background intensity

    CH1_BKD_ SD: Channel 1 background standard deviation

    CH1_Mean: Channel 1 mean intensity

    CH1_Mean - CH1_BKD_: Channel 1 mean signal

    CH1_Median: Channel 1 median intensity

    CH1_Median - CH1_BKD_: Channel 1 median signal

    CH1_SD: Channel 1 mean standard deviation

    CH2_BKD_ Mean: Channel 2 mean background intensity

    CH2_BKD_ Median: Channel 2 median background intensity

    CH2_BKD_ SD: Channel 2 background standard deviation

    CH2_Mean: Channel 2 mean intensity

    CH2_Mean - CH2_BKD_: Channel 2 mean signal

    CH2_Median: Channel 2 median intensity

    CH2_Median - CH2_BKD_: Channel 2 median signal

    CH2_SD: Channel 2 mean standard deviation

    Flags: 0 denotes satisfactory features, while <
    0 denotes features that did not meet

    ID_REF: 

    Ratio of Means: Unnormalized, untransformed ratio of mea
    ns

    VALUE: Normalized log2 ratio of means defined a
    s CH1 divided by CH2

0: ID_REF	VALUE	CH1_Median	CH1_Mean	CH1_SD	CH1_BKD_ Median	CH1_BKD_ Mean	CH1_BKD_ SD	% > CH1_BKD_+2SD	CH2_Median	CH2_Mean	CH2_SD	CH2_BKD_ Median	CH2_BKD_ Mean	CH2_BKD_ SD	% > CH2_BKD_+2SD	Ratio of Means	AREA	BKD_AREA	CH1_Median - CH1_BKD_	CH2_Median - CH2_BKD_	CH1_Mean - CH1_BKD_	CH2_Mean - CH2_BKD_	Flags	
1: 1	17.07	36	40	11	37	40	12	5	39	38	5	38	39	6	1	100000	80	540	-1	1	3	0	-50	
2: 2	-0.25	47	51	18	37	39	10	30	60	62	15	39	39	6	71	0.609	52	408	10	21	14	23	-50	
3: 3	-0.53	46	49	16	37	40	12	15	62	62	13	38	39	5	86	0.5	52	318	9	24	12	24	-50	
4: 4	17.07	36	40	12	36	40	12	10	39	39	6	39	39	6	5	100000	80	489	0	0	4	0	-50	
5: 5	1.28	178	251	175	36	41	12	95	116	161	103	39	39	6	95	1.762	80	476	142	77	215	122	0	
6: 6	0.83	56	64	31	37	41	18	32	57	60	18	39	39	7	57	1.286	80	514	19	18	27	21	-50	
7: 7	0.86	59	63	32	38	40	12	32	55	58	14	39	39	7	57	1.316	52	382	21	16	25	19	-50	
8: 8	2.12	124	144	75	37	40	12	95	72	73	15	39	39	6	88	3.147	80	554	87	33	107	34	0	
9: 9	-0.24	59	66	26	36	40	12	48	92	87	19	38	39	6	96	0.612	52	400	23	54	30	49	-50	
10: 10	0.64	63	63	20	37	40	11	53	58	61	12	38	39	6	75	1.13	80	502	26	20	26	23	-50	
11: 11	0.39	50	57	21	38	41	12	31	57	58	11	38	39	7	62	0.95	32	171	12	19	19	20	-50	
12: 12	-0.05	57	59	21	38	42	15	25	69	69	13	39	40	6	96	0.7	52	330	19	30	21	30	-50	
13: 13	-0.30	76	77	28	37	40	13	67	106	107	20	39	40	6	100	0.588	52	390	39	67	40	68	0	
14: 14	0.11	166	170	60	36	39	12	100	210	210	38	39	39	7	100	0.784	52	380	130	171	134	171	0	
15: 15	0.92	1356	1345	447	38	42	15	100	1004	993	331	39	40	10	100	1.37	52	380	1318	965	1307	954	0	
16: 16	2.92	183	193	62	39	42	12	100	66	67	14	39	39	6	88	5.5	80	476	144	27	154	28	0	
17: 17	-0.12	54	58	17	36	39	12	36	70	71	14	38	39	6	93	0.667	80	535	18	32	22	33	-50	
18: 18	-1.08	59	62	24	36	39	11	51	109	114	36	38	39	5	100	0.342	80	466	23	71	26	76	-50	
19: 19	17.07	36	41	13	38	41	11	11	39	38	5	38	39	5	1	100000	80	485	-2	1	3	0	-50	
20: 20	0.05	50	52	20	37	41	24	5	56	58	16	38	39	7	63	0.75	52	371	13	18	15	20	-50	

GEO Type: SAMPLE
GEO Id: HS-5 cells rep2
Sample_characteristics_ch1: Human bone marrow stromal cells, HS-5

Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S
tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap
proximating the expression profile of the majority of human genes was used.

Sample_data_processing: After background correction and removal 
of flagged values, log base 2 expression ratios were mean centered and linear tr
ansformed to obtain the log and linear values given in the data table.

Sample_description: Human bone marrow stromal cells, HS-5 ce
lls

Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag
en RNeasy Mini Kit reagents. The RNA (30 g) was annealed with 5 g oligo dT12-1
8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f
or 2h at 42C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d
TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re
moved from the reaction with a Microcon-30 concentrator.

Sample_extract_protocol_ch2: The RNA (30 g) was annealed with 5 g o
ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran
scriptase for 2h at 42C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT
P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, 
Tris was removed from the reaction with a Microcon-30 concentrator.

Sample_growth_protocol_ch1: HS-5 cells cultured in RPMI medium 1640 
containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 ce
lls/flask. They were cultured for 3 days and harvested by trypsinization followe
d by pelleting of the cells.

Sample_label_ch1: Cy5

Sample_label_ch2: Cy3

Sample_label_protocol_ch1: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
 a QIAquick PCR purification kit and suspended in 36 l of 3X SSC and 0.8 mg/ml 
of poly-A for hybridization to the microarray.

Sample_label_protocol_ch2: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
 a QIAquick PCR purification kit and suspended in 36 l of 3X SSC and 0.8 mg/ml 
of poly-A for hybridization to the microarray.

Sample_molecule_ch1: total RNA

Sample_molecule_ch2: total RNA

Sample_organism_ch1: Homo sapiens

Sample_organism_ch2: Homo sapiens

Sample_platform_id: GPL1001

Sample_scan_protocol: Fluorescent array images were collected 
for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit
y data were extracted and analyzed with GenePix Pro 3.0 analysis software.

Sample_source_name_ch1: Human bone marrow stromal cells, HS-5

Sample_source_name_ch2: Universal human reference RNA

Sample_title: HS-5 cells, replicate 2

Column Header Definitions
    % > CH1_BKD_+2SD: Percent of feature pixels that were grea
    ter than two standard deviations of

    % > CH2_BKD_+2SD: Percent of feature pixels that were grea
    ter than two standard deviations of the background over the background signal

    AREA: Number of pixels used to calculate a fea
    ture's intensity

    BKD_AREA: Number of pixles used to calculate a fea
    ture's background

    CH1_BKD_ Mean: Channel 1 mean background intensity

    CH1_BKD_ Median: Channel 1 median background intensity

    CH1_BKD_ SD: Channel 1 background standard deviation

    CH1_Mean: Channel 1 mean intensity

    CH1_Mean - CH1_BKD_: Channel 1 mean signal

    CH1_Median: Channel 1 median intensity

    CH1_Median - CH1_BKD_: Channel 1 median signal

    CH1_SD: Channel 1 mean standard deviation

    CH2_BKD_ Mean: Channel 2 mean background intensity

    CH2_BKD_ Median: Channel 2 median background intensity

    CH2_BKD_ SD: Channel 2 background standard deviation

    CH2_Mean: Channel 2 mean intensity

    CH2_Mean - CH2_BKD_: Channel 2 mean signal

    CH2_Median: Channel 2 median intensity

    CH2_Median - CH2_BKD_: Channel 2 median signal

    CH2_SD: Channel 2 mean standard deviation

    Flags: 0 denotes satisfactory features, while <
    0 denotes features that did not meet

    ID_REF: 

    Ratio of Means: Unnormalized, untransformed ratio of mea
    ns

    VALUE: Normalized log2 ratio of means defined a
    s CH1 divided by CH2

0: ID_REF	VALUE	CH1_Median	CH1_Mean	CH1_SD	CH1_BKD_ Median	CH1_BKD_ Mean	CH1_BKD_ SD	% > CH1_BKD_+2SD	CH2_Median	CH2_Mean	CH2_SD	CH2_BKD_ Median	CH2_BKD_ Mean	CH2_BKD_ SD	% > CH2_BKD_+2SD	Ratio of Means	AREA	BKD_AREA	CH1_Median - CH1_BKD_	CH2_Median - CH2_BKD_	CH1_Mean - CH1_BKD_	CH2_Mean - CH2_BKD_	Flags	
1: 1	3.74	39	44	16	37	40	13	10	42	42	8	41	42	8	2	7	80	473	2	1	7	1	-50	
2: 2	-0.14	46	46	15	37	40	13	10	57	58	14	39	40	7	53	0.474	80	549	9	18	9	19	-50	
3: 3	-0.31	47	47	18	36	40	13	16	65	66	18	40	41	7	75	0.423	80	554	11	25	11	26	-50	
4: 4	3.74	40	43	12	36	40	12	10	40	40	7	39	40	8	1	7	80	480	4	1	7	1	-50	
5: 5	0.60	74	91	55	37	41	14	60	95	108	45	40	41	8	93	0.794	80	532	37	55	54	68	0	
6: 6	0.86	60	58	19	38	42	14	33	59	60	14	39	40	8	60	0.952	80	555	22	20	20	21	-50	
7: 7	0.67	47	48	14	38	42	14	7	50	52	11	40	41	8	30	0.833	52	392	9	10	10	12	-50	
8: 8	0.71	51	56	22	38	41	13	31	62	61	14	40	41	7	66	0.857	80	516	13	22	18	21	-50	
9: 9	0.09	49	52	18	37	40	13	21	67	67	18	40	41	7	75	0.556	120	699	12	27	15	27	-50	
10: 10	-0.29	45	49	16	40	44	16	9	62	62	14	41	42	10	53	0.429	32	232	5	21	9	21	-50	
11: 11	-0.18	42	46	15	40	44	15	10	52	52	11	39	40	8	33	0.462	80	488	2	13	6	13	-50	
12: 12	-0.87	45	49	18	39	42	15	10	75	75	15	40	41	8	88	0.286	80	521	6	35	10	35	-50	
13: 13	-0.04	64	69	27	37	41	13	51	100	102	23	39	41	8	98	0.508	80	467	27	61	32	63	-50	
14: 14	-1.75	58	63	22	37	41	14	38	206	208	43	40	41	8	100	0.155	80	468	21	166	26	168	-50	
15: 15	1.32	643	731	413	38	42	15	100	543	569	218	40	41	7	100	1.31	80	537	605	503	693	529	0	
16: 16	2.58	162	168	74	37	41	13	98	80	83	22	41	42	8	93	3.119	80	458	125	39	131	42	0	
17: 17	-0.75	42	46	15	37	40	12	12	67	69	16	40	41	8	82	0.31	80	470	5	27	9	29	-50	
18: 18	-1.39	41	45	16	38	41	13	8	67	75	29	40	41	9	68	0.2	80	555	3	27	7	35	-50	
19: 19	0.00	40	42	14	37	40	12	10	39	39	7	40	40	7	2	-5	80	464	3	-1	5	-1	-50	
20: 20	-0.65	38	42	15	37	40	14	3	53	55	13	40	41	8	37	0.333	80	549	1	13	5	15	-50	



Testing Bio.Geo on soft_ex_family.txt


GEO Type: PLATFORM
GEO Id: GEO Human 15K v2.0
Platform_coating: unknown

Platform_contributor: Jane,Doe

Platform_contributor: John,A,Smith

Platform_contributor: Hans,van Elton

Platform_contributor: John,Smithers Jr

Platform_contributor: Jie,D,Chen

Platform_description: This set includes 13971 oligonucleotides
, mostly 70-mers, designed based upon representative sequences in build 155 of t
he human UniGene database.

Platform_distribution: non-commercial

Platform_manufacture_protocol: as described in GEO Labs manual

Platform_manufacturer: GEO Labs

Platform_organism: Homo sapiens

Platform_pubmed_id: 123456789

Platform_support: glass

Platform_technology: spotted oligonucleotide

Platform_title: Human 15K long oligo array version 2.0

Platform_web_link: http://geo.best-arrays.org

Column Header Definitions
    COLUMN: Column within array

    FLAG: Passed validation

    GB_ACC: GenBank accession number of sequence use
    d to design oligonucleotide probe   LINK_PRE:"http://www.ncbi.nlm.nih.gov/entrez
    /query.fcgi?cmd

    GENE_NAME: Descriptive gene name, from UniGene Buil
    d 155

    GENE_SYMBOL: Gene symbol, from UniGene Build 155

    ID: 

    LOCUSLINK: LocusLink identifier   LINK_PRE:"http://
    www.ncbi.nlm.nih.gov/LocusLink/LocRpt.cgi?l

    PLATE_ID: Plate identifier

    ROW: Row within array

    SEQUENCE: Sequence of oligonucleotide probe

    TIP_ID: Print tip ID

    UNIGENE: UniGene cluster ID, Build 155   LINK_PRE
    :"http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG

0: ID	GB_ACC	GENE_NAME	UNIGENE	LOCUSLINK	GENE_SYMBOL	TIP_ID	ROW	COLUMN	PLATE_ID	FLAG	SEQUENCE	
1: 1	NM_012115	CASP8 associated protein 2	122843	9994	CASP8AP2	1	1	1	HK1A1	1	GAGGGCCATCATTTAAAACATTTGCATATTTAGCCGCCAAGTTGGATAAAAATCCAAATCAGGTCTCAGA	
2: 2	AF035444	tumor suppressing subtransferable candidate 3	154036	7262	TSSC3	5	1	1	HK1A2	1	CTCATCCAGTCATGCGGGGCTGGTGTGAAAGGCGCTGGGAACCGGCTTTGAATGAATAAATGAATCGTGT	
3: 3	AK001420	PEF protein with a long N-terminal hydrophobic domain (peflin)	241531	23578	PEF	1	3	1	HK1A3	1	AATCTGACCAAGCATGAGAGAGATCTGTCTATGGGACCAGTGGCTTGGATTCTGCCACACCCATAAATCC	
4: 4	M55150	fumarylacetoacetate hydrolase (fumarylacetoacetase)	73875	2184	FAH	5	3	1	HK1A4	1	TCCTGCCATCATGAGATTTTCTCTGCTCTTCTGGAAACAAAGGGCTCAAGCACCCCTTTCAACCCTGTGA	
5: 5	AL121964					1	5	1	HK1A5	1	TCCCTGTGAAACTTTGGTTTCTTTCTATAAATGTGTGTGGTTTTCAGCGCTCAACTCCTGTCTTCAAATG	
6: 6	NM_012094	peroxiredoxin 5	31731	25824	PRDX5	5	5	1	HK1A6	1	AATATCATCTCACAGCTCTGAGGCCCTGGGCCAGATTACTTCCTCCACCCCTCCCTATCTCACCTGCCCA	
7: 7	AK001917	programmed cell death 6	80019	10016	PDCD6	1	7	1	HK1A7	1	TGTCACGTGGGGACCCAGCTGTACATATGTGGATAAGCTGATTAATGGTTTTGCAACTGTAATAGTAGCT	
8: 8	AF135794	v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)	278582	10000	AKT3	5	7	1	HK1A8	1	CTTTGGGAGAAGAGATGCTGCCATTTAACCCCTTGGTACTGAAAATGAGAAAATCCCCAACTATGCATGC	
9: 9	U43342	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	248037	4773	NFATC2	1	9	1	HK1A9	1	CTACTTGGATGATGTTAATGAAATTATCAGGAAGGAGTTTTCAGGACCTCCTGCCAGAAATCAGACGTAA	
10: 10	AF067724	non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)	72050	8382	NME5	5	9	1	HK1A10	1	TTTCATGCTCATGTGTCAGATATGCTTCCCTCAAACCTTGTTACAGCATCATCACATTACCTGTTTGATG	
11: 11	M13452	lamin A/C	77886	4000	LMNA	1	11	1	HK1A11	1	GAGCCCTTGCCTCCCCATTTCCCATCTGCACCCCTTCTCTCCTCCCCAAATCAATACACTAGTTGTTTCT	
12: 12	AJ242832	calpain 11	225953	11131	CAPN11	5	11	1	HK1A12	1	TGAACAACAAGGTAATGCAGGTCCTGGTGGCCAGGTATGCAGATGATGACCTGATCATAGACTTTGACAG	
13: 13	AF041378	cell death-inducing DFFA-like effector a	249129	1149	CIDEA	2	1	1	HK1B1	1	AGGACTTCATCGGCTGCCTTAACGTGAAGGCCACCATGTATGAGATGTACTCCGTGTCCTACGACATCCG	
14: 14	AF014955	programmed cell death 5	166468	9141	PDCD5	6	1	1	HK1B2	1	GAAAAGTAATGGACTCTGATGAAGATGACGATTATTGAACTACAAGTGCTCACAGACTAGAACTTAACGG	
15: 15	D50857	dedicator of cyto-kinesis 1	82295	1793	DOCK1	2	3	1	HK1B3	1	TGTTCCAGCCGGTGGTGTGACTTCGTTGGTTGAGGTGTGTCTCCAACCTACATCAGACCATGAAGTTCAA	
16: 16	AB011414	Kruppel-type zinc finger (C2H2)	142150	10224	ZK1	6	3	1	HK1B4	1	TGATACCTGCTGGGTATTGGTTCCAGCACTCCGTGAGCCATGTCCAGTCCCTTTTATAAAATGACATGTT	
17: 17	AF064019	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)	133089	1677	DFFB	2	5	1	HK1B5	1	CGGTCTGGAAGGAAACACGCGGATCTGAACAGCAGTAATCCTGGGGGATACGGGGGTTGGGCTAGATTAC	
18: 18	U83857	apoptosis inhibitor 5	227913	8539	API5	6	5	1	HK1B6	1	TCACCGTTCCCCTTCCCTTTCGTAAGGCAATAGTGCACAACTTAGGTTATTTTTGCTTCCGAATTTGAAT	
19: 19	J05243	spectrin, alpha, non-erythrocytic 1 (alpha-fodrin)	77196	6709	SPTAN1	2	7	1	HK1B7	1	TAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGACCCAG	
20: 20	AB014541	apoptosis-associated tyrosine kinase	128316	9625	AATK	6	7	1	HK1B8	1	ATGTAAAGTTTATTGTTGCTTCGCAGGGGGATTTGTTTTGTGTTTTGTTTGAGGCTTAGAACGCTGGTGC	

GEO Type: SAMPLE
GEO Id: HS-5 cells rep 1
Sample_characteristics_ch1: Human bone marrow stromal cells, HS-5

Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S
tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap
proximating the expression profile of the majority of human genes was used.

Sample_data_processing: After background correction and removal 
of flagged values, log base 2 expression ratios were mean centered and linear tr
ansformed to obtain the log and linear values given in the data table.

Sample_description: Human bone marrow stromal cells, HS-5 ce
lls

Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag
en RNeasy Mini Kit reagents. The RNA (30 g) was annealed with 5 g oligo dT12-1
8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f
or 2h at 42C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d
TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re
moved from the reaction with a Microcon-30 concentrator.

Sample_extract_protocol_ch2: The RNA (30 g) was annealed with 5 g o
ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran
scriptase for 2h at 42C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT
P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, 
Tris was removed from the reaction with a Microcon-30 concentrator.

Sample_growth_protocol_ch1: HS-5 cells cultured in RPMI medium 1640 
containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 ce
lls/flask. They were cultured for 3 days and harvested by trypsinization followe
d by pelleting of the cells.

Sample_label_ch1: Cy5

Sample_label_ch2: Cy3

Sample_label_protocol_ch1: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
 a QIAquick PCR purification kit and suspended in 36 l of 3X SSC and 0.8 mg/ml 
of poly-A for hybridization to the microarray.

Sample_label_protocol_ch2: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
 a QIAquick PCR purification kit and suspended in 36 l of 3X SSC and 0.8 mg/ml 
of poly-A for hybridization to the microarray.

Sample_molecule_ch1: total RNA

Sample_molecule_ch2: total RNA

Sample_organism_ch1: Homo sapiens

Sample_organism_ch2: Homo sapiens

Sample_platform_id: GEO Human 15K v2.0

Sample_scan_protocol: Fluorescent array images were collected 
for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit
y data were extracted and analyzed with GenePix Pro 3.0 analysis software.

Sample_source_name_ch1: Human bone marrow stromal cells, HS-5 ce
lls

Sample_source_name_ch2: Universal human reference RNA

Sample_title: Human bone marrow stromal cells, HS-5 ce
lls, replicate 1

Column Header Definitions
    % > CH1_BKD_+2SD: Percent of feature pixels that were grea
    ter than two standard deviations of

    % > CH2_BKD_+2SD: Percent of feature pixels that were grea
    ter than two standard deviations of the background over the background signal

    AREA: Number of pixels used to calculate a fea
    ture's intensity

    BKD_AREA: Number of pixles used to calculate a fea
    ture's background

    CH1_BKD_ Mean: Channel 1 mean background intensity

    CH1_BKD_ Median: Channel 1 median background intensity

    CH1_BKD_ SD: Channel 1 background standard deviation

    CH1_Mean: Channel 1 mean intensity

    CH1_Mean - CH1_BKD_: Channel 1 mean signal

    CH1_Median: Channel 1 median intensity

    CH1_Median - CH1_BKD_: Channel 1 median signal

    CH1_SD: Channel 1 mean standard deviation

    CH2_BKD_ Mean: Channel 2 mean background intensity

    CH2_BKD_ Median: Channel 2 median background intensity

    CH2_BKD_ SD: Channel 2 background standard deviation

    CH2_Mean: Channel 2 mean intensity

    CH2_Mean - CH2_BKD_: Channel 2 mean signal

    CH2_Median: Channel 2 median intensity

    CH2_Median - CH2_BKD_: Channel 2 median signal

    CH2_SD: Channel 2 mean standard deviation

    Flags: 0 denotes satisfactory features, while <
    0 denotes features that did not meet

    ID_REF: 

    Ratio of Means: Unnormalized, untransformed ratio of mea
    ns

    VALUE: Normalized log2 ratio of means defined a
    s CH1 divided by CH2

0: ID_REF	VALUE	CH1_Median	CH1_Mean	CH1_SD	CH1_BKD_ Median	CH1_BKD_ Mean	CH1_BKD_ SD	% > CH1_BKD_+2SD	CH2_Median	CH2_Mean	CH2_SD	CH2_BKD_ Median	CH2_BKD_ Mean	CH2_BKD_ SD	% > CH2_BKD_+2SD	Ratio of Means	AREA	BKD_AREA	CH1_Median - CH1_BKD_	CH2_Median - CH2_BKD_	CH1_Mean - CH1_BKD_	CH2_Mean - CH2_BKD_	Flags	
1: 1	17.51	36	38	9	37	38	8	5	45	46	9	46	47	10	0	100000	80	500	-1	-1	1	0	-50	
2: 2	-0.10	42	47	19	37	39	11	12	64	65	15	45	47	10	43	0.5	32	176	5	19	10	20	-50	
3: 3	-0.42	44	48	18	36	38	8	37	75	75	17	45	46	10	71	0.4	32	176	8	30	12	30	-50	
4: 4	17.51	37	40	11	37	39	10	11	42	43	8	43	43	8	2	100000	80	498	0	-1	3	0	-50	
5: 5	0.95	147	193	125	37	39	8	98	157	194	109	43	44	9	98	1.033	52	398	110	114	156	151	0	
6: 6	0.79	57	62	21	37	39	9	55	69	71	14	44	45	8	76	0.926	52	329	20	25	25	27	-50	
7: 7	0.12	45	48	16	37	40	10	28	64	64	14	45	46	9	50	0.579	32	224	8	19	11	19	-50	
8: 8	0.68	54	54	17	36	38	9	48	63	64	13	43	44	8	57	0.857	80	510	18	20	18	21	-50	
9: 9	-0.10	51	53	16	36	38	9	44	73	77	19	43	44	9	84	0.5	52	406	15	30	17	34	-50	
10: 10	0.15	47	50	15	37	39	8	38	65	65	14	43	44	9	63	0.591	52	332	10	22	13	22	-50	
11: 11	-1.42	38	40	12	37	39	10	9	58	60	13	45	47	10	31	0.2	32	148	1	13	3	15	-50	
12: 12	-0.58	44	47	15	37	39	9	22	70	71	16	43	44	9	70	0.357	80	506	7	27	10	28	-50	
13: 13	0.08	63	63	24	36	38	9	63	85	91	21	43	44	9	94	0.563	52	382	27	42	27	48	0	
14: 14	-1.05	63	69	23	37	38	9	69	168	167	32	43	45	8	100	0.258	52	382	26	125	32	124	0	
15: 15	1.02	439	452	225	37	39	9	98	428	425	198	43	44	8	93	1.086	80	546	402	385	415	382	0	
16: 16	2.07	86	91	30	37	39	9	88	66	67	15	43	44	8	70	2.25	80	540	49	23	54	24	0	
17: 17	-0.79	40	44	14	36	39	10	11	67	69	15	43	44	9	73	0.308	52	384	4	24	8	26	-50	
18: 18	-0.57	50	51	16	37	39	10	37	79	82	22	43	44	9	83	0.359	80	570	13	36	14	39	-50	
19: 19	1.90	37	39	10	37	39	10	5	44	44	8	43	44	9	1	2	80	475	0	1	2	1	-50	
20: 20	-0.99	42	44	11	37	39	9	9	65	69	16	43	45	9	61	0.269	52	388	5	22	7	26	-50	

GEO Type: SAMPLE
GEO Id: HS-27a cells
Sample_characteristics_ch1: Human bone marrow stromal cells, HS-27a

Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S
tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap
proximating the expression profile of the majority of human genes was used.

Sample_data_processing: After background correction and removal 
of flagged values, log base 2 expression ratios were mean centered and linear tr
ansformed to obtain the log and linear values given in the data table.

Sample_description: Human bone marrow stromal cells, HS-27a 
cells

Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag
en RNeasy Mini Kit reagents. The RNA (30 g) was annealed with 5 g oligo dT12-1
8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f
or 2h at 42C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d
TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re
moved from the reaction with a Microcon-30 concentrator.

Sample_extract_protocol_ch2: The RNA (30 g) was annealed with 5 g o
ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran
scriptase for 2h at 42C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT
P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, 
Tris was removed from the reaction with a Microcon-30 concentrator.

Sample_growth_protocol_ch1: HS-27a cells cultured in RPMI medium 164
0 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 
cells/flask. They were cultured for 3 days and harvested by trypsinization follo
wed by pelleting of the cells.

Sample_label_ch1: Cy5

Sample_label_ch2: Cy3

Sample_label_protocol_ch1: The cDNA from HS-27a RNA and Human Unive
rsal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors,
 respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2
.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified wi
th a QIAquick PCR purification kit and suspended in 36 l of 3X SSC and 0.8 mg/m
l of poly-A for hybridization to the microarray.

Sample_label_protocol_ch2: The cDNA from HS-27a RNA and Human Unive
rsal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors,
 respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2
.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified wi
th a QIAquick PCR purification kit and suspended in 36 l of 3X SSC and 0.8 mg/m
l of poly-A for hybridization to the microarray.

Sample_molecule_ch1: total RNA

Sample_molecule_ch2: total RNA

Sample_organism_ch1: Homo sapiens

Sample_organism_ch2: Homo sapiens

Sample_platform_id: GEO Human 15K v2.0

Sample_scan_protocol: Fluorescent array images were collected 
for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit
y data were extracted and analyzed with GenePix Pro 3.0 analysis software.

Sample_source_name_ch1: Human bone marrow stromal cells, HS-27a

Sample_source_name_ch2: Universal human reference RNA

Sample_title: HS-27a cells.

Column Header Definitions
    % > CH1_BKD_+2SD: Percent of feature pixels that were grea
    ter than two standard deviations of

    % > CH2_BKD_+2SD: Percent of feature pixels that were grea
    ter than two standard deviations of the background over the background signal

    AREA: Number of pixels used to calculate a fea
    ture's intensity

    BKD_AREA: Number of pixles used to calculate a fea
    ture's background

    CH1_BKD_ Mean: Channel 1 mean background intensity

    CH1_BKD_ Median: Channel 1 median background intensity

    CH1_BKD_ SD: Channel 1 background standard deviation

    CH1_Mean: Channel 1 mean intensity

    CH1_Mean - CH1_BKD_: Channel 1 mean signal

    CH1_Median: Channel 1 median intensity

    CH1_Median - CH1_BKD_: Channel 1 median signal

    CH1_SD: Channel 1 mean standard deviation

    CH2_BKD_ Mean: Channel 2 mean background intensity

    CH2_BKD_ Median: Channel 2 median background intensity

    CH2_BKD_ SD: Channel 2 background standard deviation

    CH2_Mean: Channel 2 mean intensity

    CH2_Mean - CH2_BKD_: Channel 2 mean signal

    CH2_Median: Channel 2 median intensity

    CH2_Median - CH2_BKD_: Channel 2 median signal

    CH2_SD: Channel 2 mean standard deviation

    Flags: 0 denotes satisfactory features, while <
    0 denotes features that did not meet

    ID_REF: 

    Ratio of Means: Unnormalized, untransformed ratio of mea
    ns

    VALUE: Normalized log2 ratio of means defined a
    s CH1 divided by CH2

0: ID_REF	VALUE	CH1_Median	CH1_Mean	CH1_SD	CH1_BKD_ Median	CH1_BKD_ Mean	CH1_BKD_ SD	% > CH1_BKD_+2SD	CH2_Median	CH2_Mean	CH2_SD	CH2_BKD_ Median	CH2_BKD_ Mean	CH2_BKD_ SD	% > CH2_BKD_+2SD	Ratio of Means	AREA	BKD_AREA	CH1_Median - CH1_BKD_	CH2_Median - CH2_BKD_	CH1_Mean - CH1_BKD_	CH2_Mean - CH2_BKD_	Flags	
1: 1	17.07	36	40	11	37	40	12	5	39	38	5	38	39	6	1	100000	80	540	-1	1	3	0	-50	
2: 2	-0.25	47	51	18	37	39	10	30	60	62	15	39	39	6	71	0.609	52	408	10	21	14	23	-50	
3: 3	-0.53	46	49	16	37	40	12	15	62	62	13	38	39	5	86	0.5	52	318	9	24	12	24	-50	
4: 4	17.07	36	40	12	36	40	12	10	39	39	6	39	39	6	5	100000	80	489	0	0	4	0	-50	
5: 5	1.28	178	251	175	36	41	12	95	116	161	103	39	39	6	95	1.762	80	476	142	77	215	122	0	
6: 6	0.83	56	64	31	37	41	18	32	57	60	18	39	39	7	57	1.286	80	514	19	18	27	21	-50	
7: 7	0.86	59	63	32	38	40	12	32	55	58	14	39	39	7	57	1.316	52	382	21	16	25	19	-50	
8: 8	2.12	124	144	75	37	40	12	95	72	73	15	39	39	6	88	3.147	80	554	87	33	107	34	0	
9: 9	-0.24	59	66	26	36	40	12	48	92	87	19	38	39	6	96	0.612	52	400	23	54	30	49	-50	
10: 10	0.64	63	63	20	37	40	11	53	58	61	12	38	39	6	75	1.13	80	502	26	20	26	23	-50	
11: 11	0.39	50	57	21	38	41	12	31	57	58	11	38	39	7	62	0.95	32	171	12	19	19	20	-50	
12: 12	-0.05	57	59	21	38	42	15	25	69	69	13	39	40	6	96	0.7	52	330	19	30	21	30	-50	
13: 13	-0.30	76	77	28	37	40	13	67	106	107	20	39	40	6	100	0.588	52	390	39	67	40	68	0	
14: 14	0.11	166	170	60	36	39	12	100	210	210	38	39	39	7	100	0.784	52	380	130	171	134	171	0	
15: 15	0.92	1356	1345	447	38	42	15	100	1004	993	331	39	40	10	100	1.37	52	380	1318	965	1307	954	0	
16: 16	2.92	183	193	62	39	42	12	100	66	67	14	39	39	6	88	5.5	80	476	144	27	154	28	0	
17: 17	-0.12	54	58	17	36	39	12	36	70	71	14	38	39	6	93	0.667	80	535	18	32	22	33	-50	
18: 18	-1.08	59	62	24	36	39	11	51	109	114	36	38	39	5	100	0.342	80	466	23	71	26	76	-50	
19: 19	17.07	36	41	13	38	41	11	11	39	38	5	38	39	5	1	100000	80	485	-2	1	3	0	-50	
20: 20	0.05	50	52	20	37	41	24	5	56	58	16	38	39	7	63	0.75	52	371	13	18	15	20	-50	

GEO Type: SAMPLE
GEO Id: HS-5 cells rep2
Sample_characteristics_ch1: Human bone marrow stromal cells, HS-5

Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S
tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap
proximating the expression profile of the majority of human genes was used.

Sample_data_processing: After background correction and removal 
of flagged values, log base 2 expression ratios were mean centered and linear tr
ansformed to obtain the log and linear values given in the data table.

Sample_description: Human bone marrow stromal cells, HS-5 ce
lls

Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag
en RNeasy Mini Kit reagents. The RNA (30 g) was annealed with 5 g oligo dT12-1
8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f
or 2h at 42C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d
TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re
moved from the reaction with a Microcon-30 concentrator.

Sample_extract_protocol_ch2: The RNA (30 g) was annealed with 5 g o
ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran
scriptase for 2h at 42C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT
P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, 
Tris was removed from the reaction with a Microcon-30 concentrator.

Sample_growth_protocol_ch1: HS-5 cells cultured in RPMI medium 1640 
containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 ce
lls/flask. They were cultured for 3 days and harvested by trypsinization followe
d by pelleting of the cells.

Sample_label_ch1: Cy5

Sample_label_ch2: Cy3

Sample_label_protocol_ch1: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
 a QIAquick PCR purification kit and suspended in 36 l of 3X SSC and 0.8 mg/ml 
of poly-A for hybridization to the microarray.

Sample_label_protocol_ch2: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
 a QIAquick PCR purification kit and suspended in 36 l of 3X SSC and 0.8 mg/ml 
of poly-A for hybridization to the microarray.

Sample_molecule_ch1: total RNA

Sample_molecule_ch2: total RNA

Sample_organism_ch1: Homo sapiens

Sample_organism_ch2: Homo sapiens

Sample_platform_id: GEO Human 15K v2.0

Sample_scan_protocol: Fluorescent array images were collected 
for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit
y data were extracted and analyzed with GenePix Pro 3.0 analysis software.

Sample_source_name_ch1: Human bone marrow stromal cells, HS-5

Sample_source_name_ch2: Universal human reference RNA

Sample_title: HS-5 cells, replicate 2

Column Header Definitions
    % > CH1_BKD_+2SD: Percent of feature pixels that were grea
    ter than two standard deviations of

    % > CH2_BKD_+2SD: Percent of feature pixels that were grea
    ter than two standard deviations of the background over the background signal

    AREA: Number of pixels used to calculate a fea
    ture's intensity

    BKD_AREA: Number of pixles used to calculate a fea
    ture's background

    CH1_BKD_ Mean: Channel 1 mean background intensity

    CH1_BKD_ Median: Channel 1 median background intensity

    CH1_BKD_ SD: Channel 1 background standard deviation

    CH1_Mean: Channel 1 mean intensity

    CH1_Mean - CH1_BKD_: Channel 1 mean signal

    CH1_Median: Channel 1 median intensity

    CH1_Median - CH1_BKD_: Channel 1 median signal

    CH1_SD: Channel 1 mean standard deviation

    CH2_BKD_ Mean: Channel 2 mean background intensity

    CH2_BKD_ Median: Channel 2 median background intensity

    CH2_BKD_ SD: Channel 2 background standard deviation

    CH2_Mean: Channel 2 mean intensity

    CH2_Mean - CH2_BKD_: Channel 2 mean signal

    CH2_Median: Channel 2 median intensity

    CH2_Median - CH2_BKD_: Channel 2 median signal

    CH2_SD: Channel 2 mean standard deviation

    Flags: 0 denotes satisfactory features, while <
    0 denotes features that did not meet

    ID_REF: 

    Ratio of Means: Unnormalized, untransformed ratio of mea
    ns

    VALUE: Normalized log2 ratio of means defined a
    s CH1 divided by CH2

0: ID_REF	VALUE	CH1_Median	CH1_Mean	CH1_SD	CH1_BKD_ Median	CH1_BKD_ Mean	CH1_BKD_ SD	% > CH1_BKD_+2SD	CH2_Median	CH2_Mean	CH2_SD	CH2_BKD_ Median	CH2_BKD_ Mean	CH2_BKD_ SD	% > CH2_BKD_+2SD	Ratio of Means	AREA	BKD_AREA	CH1_Median - CH1_BKD_	CH2_Median - CH2_BKD_	CH1_Mean - CH1_BKD_	CH2_Mean - CH2_BKD_	Flags	
1: 1	3.74	39	44	16	37	40	13	10	42	42	8	41	42	8	2	7	80	473	2	1	7	1	-50	
2: 2	-0.14	46	46	15	37	40	13	10	57	58	14	39	40	7	53	0.474	80	549	9	18	9	19	-50	
3: 3	-0.31	47	47	18	36	40	13	16	65	66	18	40	41	7	75	0.423	80	554	11	25	11	26	-50	
4: 4	3.74	40	43	12	36	40	12	10	40	40	7	39	40	8	1	7	80	480	4	1	7	1	-50	
5: 5	0.60	74	91	55	37	41	14	60	95	108	45	40	41	8	93	0.794	80	532	37	55	54	68	0	
6: 6	0.86	60	58	19	38	42	14	33	59	60	14	39	40	8	60	0.952	80	555	22	20	20	21	-50	
7: 7	0.67	47	48	14	38	42	14	7	50	52	11	40	41	8	30	0.833	52	392	9	10	10	12	-50	
8: 8	0.71	51	56	22	38	41	13	31	62	61	14	40	41	7	66	0.857	80	516	13	22	18	21	-50	
9: 9	0.09	49	52	18	37	40	13	21	67	67	18	40	41	7	75	0.556	120	699	12	27	15	27	-50	
10: 10	-0.29	45	49	16	40	44	16	9	62	62	14	41	42	10	53	0.429	32	232	5	21	9	21	-50	
11: 11	-0.18	42	46	15	40	44	15	10	52	52	11	39	40	8	33	0.462	80	488	2	13	6	13	-50	
12: 12	-0.87	45	49	18	39	42	15	10	75	75	15	40	41	8	88	0.286	80	521	6	35	10	35	-50	
13: 13	-0.04	64	69	27	37	41	13	51	100	102	23	39	41	8	98	0.508	80	467	27	61	32	63	-50	
14: 14	-1.75	58	63	22	37	41	14	38	206	208	43	40	41	8	100	0.155	80	468	21	166	26	168	-50	
15: 15	1.32	643	731	413	38	42	15	100	543	569	218	40	41	7	100	1.31	80	537	605	503	693	529	0	
16: 16	2.58	162	168	74	37	41	13	98	80	83	22	41	42	8	93	3.119	80	458	125	39	131	42	0	
17: 17	-0.75	42	46	15	37	40	12	12	67	69	16	40	41	8	82	0.31	80	470	5	27	9	29	-50	
18: 18	-1.39	41	45	16	38	41	13	8	67	75	29	40	41	9	68	0.2	80	555	3	27	7	35	-50	
19: 19	0.00	40	42	14	37	40	12	10	39	39	7	40	40	7	2	-5	80	464	3	-1	5	-1	-50	
20: 20	-0.65	38	42	15	37	40	14	3	53	55	13	40	41	8	37	0.333	80	549	1	13	5	15	-50	

GEO Type: SERIES
GEO Id: Bone_marrow_stromal_cells
Series_contributor: Jane,,Doe

Series_contributor: John,A,Smith

Series_overall_design: We analyzed 2 arrays for HS-5 cell line 
and 1 array for HS-27a cell line

Series_pubmed_id: 123456789

Series_sample_id: HS-5 cells rep1

Series_sample_id: HS-27a cells

Series_sample_id: HS-5 cells rep2

Series_summary: Two human stromal cell lines, HS-5 and H
S-27a, represent functionally distinct components of the bone marrow microenviro
nment.1,2 HS-27a supports cobblestone area formation by early hematopoietic prog
enitors, whereas HS-5 secretes multiple cytokines that support the proliferation
 of committed progenitors. These cell lines have been distributed to research gr
oups worldwide for use as a tool to understand interactions between hematopoieti
c cells and their microenvironment. We have used DNA microarray technology to ch
aracterize and compare the expression of over 17 000 genes in these cell lines. 
Gene expression differences in cytokines/chemokines, G-protein signaling molecul
es, and multiple extracellular matrix proteins add to the known protein and func
tional characterization of the lines, leading to new insight into the difference
s in their support function for hematopoietic progenitors.

Series_title: Profiling of the functionally distinct h
uman bone marrow stromal cell lines HS-5 and HS-27a.

Series_type: other

Series_web_link: http://geo.best-arrays.org

Column Header Definitions



Testing Bio.Geo on soft_ex_platform.txt


GEO Type: PLATFORM
GEO Id: GEO Human 14K v 1.0
Platform_coating: unknown

Platform_contributor: Jane,,Doe

Platform_contributor: John,A,Smith

Platform_contributor: Hans,van Elton

Platform_contributor: John,Smithers Jr

Platform_contributor: Jie,D,Chen

Platform_description: This set includes 13971 oligonucleotides
, mostly 70-mers, designed based upon representative sequences in build 155 of t
he human UniGene database.

Platform_distribution: non-commercial

Platform_manufacture_protocol: as described in GEO Labs manual

Platform_manufacturer: GEO Labs

Platform_organism: Homo sapiens

Platform_pubmed_id: 123456789

Platform_support: glass

Platform_technology: spotted oligonucleotide

Platform_title: Human 14K long oligo array

Platform_web_link: http://geo.best-arrays.org

Column Header Definitions
    COLUMN: Column within array

    FLAG: Passed validation

    GB_ACC: GenBank accession number of sequence use
    d to design oligonucleotide probe

    GENE_NAME: Descriptive gene name, from UniGene Buil
    d 155

    GENE_SYMBOL: Gene symbol, from UniGene Build 155

    ID: 

    LOCUSLINK: LocusLink identifier

    PLATE_ID: Plate identifier

    ROW: Row within array

    SEQUENCE: Sequence of oligonucleotide probe

    TIP_ID: Print tip ID

    UNIGENE: UniGene cluster ID, Build 155

0: ID	GB_ACC	GENE_NAME	UNIGENE	LOCUSLINK	GENE_SYMBOL	TIP_ID	ROW	COLUMN	PLATE_ID	FLAG	SEQUENCE	
1: 1	NM_012115	CASP8 associated protein 2	122843	9994	CASP8AP2	1	1	1	HK1A1	1	GAGGGCCATCATTTAAAACATTTGCATATTTAGCCGCCAAGTTGGATAAAAATCCAAATCAGGTCTCAGA	
2: 2	AF035444	tumor suppressing subtransferable candidate 3	154036	7262	TSSC3	5	1	1	HK1A2	1	CTCATCCAGTCATGCGGGGCTGGTGTGAAAGGCGCTGGGAACCGGCTTTGAATGAATAAATGAATCGTGT	
3: 3	AK001420	PEF protein with a long N-terminal hydrophobic domain (peflin)	241531	23578	PEF	1	3	1	HK1A3	1	AATCTGACCAAGCATGAGAGAGATCTGTCTATGGGACCAGTGGCTTGGATTCTGCCACACCCATAAATCC	
4: 4	M55150	fumarylacetoacetate hydrolase (fumarylacetoacetase)	73875	2184	FAH	5	3	1	HK1A4	1	TCCTGCCATCATGAGATTTTCTCTGCTCTTCTGGAAACAAAGGGCTCAAGCACCCCTTTCAACCCTGTGA	
5: 5	AL121964					1	5	1	HK1A5	1	TCCCTGTGAAACTTTGGTTTCTTTCTATAAATGTGTGTGGTTTTCAGCGCTCAACTCCTGTCTTCAAATG	
6: 6	NM_012094	peroxiredoxin 5	31731	25824	PRDX5	5	5	1	HK1A6	1	AATATCATCTCACAGCTCTGAGGCCCTGGGCCAGATTACTTCCTCCACCCCTCCCTATCTCACCTGCCCA	
7: 7	AK001917	programmed cell death 6	80019	10016	PDCD6	1	7	1	HK1A7	1	TGTCACGTGGGGACCCAGCTGTACATATGTGGATAAGCTGATTAATGGTTTTGCAACTGTAATAGTAGCT	
8: 8	AF135794	v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)	278582	10000	AKT3	5	7	1	HK1A8	1	CTTTGGGAGAAGAGATGCTGCCATTTAACCCCTTGGTACTGAAAATGAGAAAATCCCCAACTATGCATGC	
9: 9	U43342	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	248037	4773	NFATC2	1	9	1	HK1A9	1	CTACTTGGATGATGTTAATGAAATTATCAGGAAGGAGTTTTCAGGACCTCCTGCCAGAAATCAGACGTAA	
10: 10	AF067724	non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)	72050	8382	NME5	5	9	1	HK1A10	1	TTTCATGCTCATGTGTCAGATATGCTTCCCTCAAACCTTGTTACAGCATCATCACATTACCTGTTTGATG	
11: 11	M13452	lamin A/C	77886	4000	LMNA	1	11	1	HK1A11	1	GAGCCCTTGCCTCCCCATTTCCCATCTGCACCCCTTCTCTCCTCCCCAAATCAATACACTAGTTGTTTCT	
12: 12	AJ242832	calpain 11	225953	11131	CAPN11	5	11	1	HK1A12	1	TGAACAACAAGGTAATGCAGGTCCTGGTGGCCAGGTATGCAGATGATGACCTGATCATAGACTTTGACAG	
13: 13	AF041378	cell death-inducing DFFA-like effector a	249129	1149	CIDEA	2	1	1	HK1B1	1	AGGACTTCATCGGCTGCCTTAACGTGAAGGCCACCATGTATGAGATGTACTCCGTGTCCTACGACATCCG	
14: 14	AF014955	programmed cell death 5	166468	9141	PDCD5	6	1	1	HK1B2	1	GAAAAGTAATGGACTCTGATGAAGATGACGATTATTGAACTACAAGTGCTCACAGACTAGAACTTAACGG	
15: 15	D50857	dedicator of cyto-kinesis 1	82295	1793	DOCK1	2	3	1	HK1B3	1	TGTTCCAGCCGGTGGTGTGACTTCGTTGGTTGAGGTGTGTCTCCAACCTACATCAGACCATGAAGTTCAA	
16: 16	AB011414	Kruppel-type zinc finger (C2H2)	142150	10224	ZK1	6	3	1	HK1B4	1	TGATACCTGCTGGGTATTGGTTCCAGCACTCCGTGAGCCATGTCCAGTCCCTTTTATAAAATGACATGTT	
17: 17	AF064019	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)	133089	1677	DFFB	2	5	1	HK1B5	1	CGGTCTGGAAGGAAACACGCGGATCTGAACAGCAGTAATCCTGGGGGATACGGGGGTTGGGCTAGATTAC	
18: 18	U83857	apoptosis inhibitor 5	227913	8539	API5	6	5	1	HK1B6	1	TCACCGTTCCCCTTCCCTTTCGTAAGGCAATAGTGCACAACTTAGGTTATTTTTGCTTCCGAATTTGAAT	
19: 19	J05243	spectrin, alpha, non-erythrocytic 1 (alpha-fodrin)	77196	6709	SPTAN1	2	7	1	HK1B7	1	TAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGACCCAG	
20: 20	AB014541	apoptosis-associated tyrosine kinase	128316	9625	AATK	6	7	1	HK1B8	1	ATGTAAAGTTTATTGTTGCTTCGCAGGGGGATTTGTTTTGTGTTTTGTTTGAGGCTTAGAACGCTGGTGC	



Testing Bio.Geo on soft_ex_series.txt


GEO Type: SERIES
GEO Id: Bone_marrow_stromal_cells
Series_contributor: Jane,Doe

Series_contributor: John,A,Smith

Series_contributor: Hans,van Elton

Series_contributor: John,Smithers Jr

Series_contributor: Jie,D,Chen

Series_overall_design: We analyzed 2 arrays for HS-5 cell line 
and 2 arrays for HS-27a cell line

Series_pubmed_id: 123456789

Series_sample_id: GSM10001

Series_sample_id: GSM10002

Series_sample_id: GSM10003

Series_sample_id: GSM10004

Series_summary: Two human stromal cell lines, HS-5 and H
S-27a, represent functionally distinct components of the bone marrow microenviro
nment.1,2 HS-27a supports cobblestone area formation by early hematopoietic prog
enitors, whereas HS-5 secretes multiple cytokines that support the proliferation
 of committed progenitors. These cell lines have been distributed to research gr
oups worldwide for use as a tool to understand interactions between hematopoieti
c cells and their microenvironment. We have used DNA microarray technology to ch
aracterize and compare the expression of over 17 000 genes in these cell lines. 
Gene expression differences in cytokines/chemokines, G-protein signaling molecul
es, and multiple extracellular matrix proteins add to the known protein and func
tional characterization of the lines, leading to new insight into the difference
s in their support function for hematopoietic progenitors.

Series_title: Profiling of the functionally distinct h
uman bone marrow stromal cell lines HS-5 and HS-27a.

Series_type: Cell Line Comparison

Series_variable_1: cell line

Series_variable_2: cell line

Series_variable_description_1: HS-5

Series_variable_description_2: HS-27a

Series_variable_sample_list_1: GSM10001, GSM10002

Series_variable_sample_list_2: GSM10003, GSM10004

Column Header Definitions



